Jump to Main Content

Variant Information

Gene Coordinates (GRCh37) Coordinates (GRCh38) Nucleotide Protein Interpretation
SRSF2 chr17:74732935 chr17:76736878 c.283C>G p.P95A Pathogenic
SRSF2 chr17:74732959 chr17:76736877 c.284C>T p.P95L Pathogenic
SRSF2 chr17:74732935 chr17:76736853 c.284_307delCCCCGGACTCACACCACAGCCGCC p.P95_R103delinsR Pathogenic